Toggle Main Menu Toggle Search

Open Access padlockePrints

The Newcastle University research output collection, currently available on ePrints, will shortly be moving to a new open repository platform, Figshare. To prepare for the data migration we have paused adding new content to ePrints, and will resume once the new repository is launched. During this time you will continue to have access to ePrints (but no new content will appear). We will share updates here when available.

Specific adducts recognised by a monoclonal antibody against cisplatin-modified DNA

Lookup NU author(s): Dr Emma Meczes, Ali Azim-Araghi, Dr Michael Tilby

Downloads

Full text for this publication is not currently held within this repository. Alternative links are provided below where available.


Abstract

Numerous clinical or experimental studies have employed monoclonal antibody CP9/19 for quantification of cisplatin DNA adducts. The nature of adducts recognised by CP9/19 on polymeric DNA were defined using synthetic deoxynucleotides reacted with cisplatin. Total adduct levels were determined by atomic absorption spectrometry. The nature of adducts formed were confirmed by analysis of enzymatic hydrolysates using an established ion-exchange chromatography method combined with inductively coupled plasma mass spectrometry. Of the Pt bound to oligonucleotide A (TTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTT), 77% was recovered in a product consistent with the expected 1,2 intra-strand cross-link between GG. For oligonucleotide B (TTTTTAGTTTTTAGTTTTTAGTTTTTAGTTTTT), 62% of the bound Pt was recovered in a product consistent with the 1,2 intra-strand cross-link between AG. Of Pt bound to oligothymydylic acid, 65% was recovered in a product not previously described, small quantities of which were also formed on oligonucleotides A and B. The concentrations of adducts required to cause 50% reduction of signal in a competitive enzyme-linked immunosorbant assay (ELISA) (K-values) were determined. Adducts on sequences containing no guanine or only non-adjacent guanine residues, including sequences containing adenines adjacent to guanines, exhibited low or undetectable immunoreactivities (K-values = from 1 to >100 pmoles Pt per assay well). Adducts formed on oligodeoxynucleotides containing guanine doublets interspersed amongst thymine residues were the most immunoreactive (K-values: 2-7 fmoles adduct per assay well), comparable to adducts on calf-thymus DNA. The only cisplatin-DNA adducts recognised with high sensitivity by antibody CP9/19 were those involving adjacent guanine residues but immunorecognition of these was influenced by the surrounding DNA sequence. © 2005 Elsevier Inc. All rights reserved.


Publication metadata

Author(s): Meczes, E., Azim-Araghi, A., Ottley, C., Pearson, D.G., Tilby, M.J.

Publication type: Article

Publication status: Published

Journal: Biochemical Pharmacology

Year: 2005

Volume: 70

Issue: 12

Pages: 1717-1725

Print publication date: 05/12/2005

ISSN (print): 0006-2952

ISSN (electronic): 1873-2968

URL: http://dx.doi.org/10.1016/j.bcp.2005.09.025

DOI: 10.1016/j.bcp.2005.09.025

PubMed id: 16259963


Altmetrics

Altmetrics provided by Altmetric


Share